Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 1007258
End position: 1007281
Length: 24

DNA sequence
>NC_008789, from 1007258 to 1007281 (24 bp); Halorhodospira halophila SL1 CCCGGCCCCGGCGCCGGCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1007210-1008226	Sequence	Hhal_0930 - hypothetical protein (Protein is coded in complementary strand; from 1008226 to 1007210)