Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 1004354
End position: 1004377
Length: 24

DNA sequence
>NC_008789, from 1004354 to 1004377 (24 bp); Halorhodospira halophila SL1 CGGCCTCCGCCTCGCCCTCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1002505-1006188	Sequence	Hhal_0928 - hypothetical protein (Protein is coded in complementary strand; from 1006188 to 1002505)