Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 999579
End position: 999605
Length: 27

DNA sequence
>NC_008769, from 999579 to 999605 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCGTTGCCGCCGCTGCCGCCGTTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 998875-1000704	Sequence	BCG_0924c PE_PGRS15 PE-PGRS family protein (Protein is coded in complementary strand; from 1000704 to 998875)