Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 85183
End position: 85212
Length: 30

DNA sequence
>NC_008769, from 85183 to 85212 (30 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCGCCGCCGCCGCCTCCGCCGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 83313-85358	Sequence	BCG_0081 ponA1 bifunctional penicillin-binding protein 1A/1B PONA1