Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 597142
End position: 597186
Length: 45

DNA sequence
>NC_008769, from 597142 to 597186 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCAAGAAGGCGGCGGCCAAGAAGGCGCCCGCGAAGAAGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 596612-597211	Sequence	BCG_0516 hbhA Heparin binding hemagglutinin hbhA