Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 565893
End position: 565916
Length: 24

DNA sequence
>NC_008769, from 565893 to 565916 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCGGCGGCGACGGCGACGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 565260-566030	Sequence	BCG_0485c - hypothetical protein (Protein is coded in complementary strand; from 566030 to 565260)