Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 54341
End position: 54394
Length: 54

DNA sequence
>NC_008769, from 54341 to 54394 (54 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GGTACCCGCGCTGGTCGGGGTAGCCGCGTTGCTCGGGGTAACCGCCCTGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 53527-55092	Sequence	BCG_0050c TB39.8 hypothetical protein (Protein is coded in complementary strand; from 55092 to 53527)