Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 405518
End position: 405562
Length: 45

DNA sequence
>NC_008769, from 405518 to 405562 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CTCCAGTGTTGTAGTCGCCGGTGTTGAAGTAGCCGGTGTTGTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 400711-406638	Sequence	BCG_0345c PPE6 PPE family protein (Protein is coded in complementary strand; from 406638 to 400711)