Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3951136
End position: 3951171
Length: 36

DNA sequence
>NC_008769, from 3951136 to 3951171 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCGCCGCCGCCGCCATCGCCGCCGCCGCCGGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3949597-3951345	Sequence	BCG_3597c PPE62 PPE family protein (Protein is coded in complementary strand; from 3951345 to 3949597)