Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3916266
End position: 3916292
Length: 27

DNA sequence
>NC_008769, from 3916266 to 3916292 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGGCGGGACCGGCGGGACCGGCGGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3910475-3916759	Sequence	BCG_3572 PE_PGRS54 PE-PGRS family protein