Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3907688
End position: 3907723
Length: 36

DNA sequence
>NC_008769, from 3907688 to 3907723 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 AACGGCGGCAACGGCGGCAACGGCGGCAACGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3906066-3910184	Sequence	BCG_3571 PE_PGRS53 PE-PGRS family protein