Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3898815
End position: 3898838
Length: 24

DNA sequence
>NC_008769, from 3898815 to 3898838 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCCGACCGCGACCCCGACCCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3898717-3899559	Sequence	BCG_3564c yrbE4B integral membrane protein YrbE4b (Protein is coded in complementary strand; from 3899559 to 3898717)