Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3858464
End position: 3858499
Length: 36

DNA sequence
>NC_008769, from 3858464 to 3858499 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TCGGGGGCCTCTGCGGGGGGCTCTTCGGGGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3858458-3859000	Sequence	BCG_3521c rplQ 50S ribosomal protein L17 (Protein is coded in complementary strand; from 3859000 to 3858458)