Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3840290
End position: 3840316
Length: 27

DNA sequence
>NC_008769, from 3840290 to 3840316 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GGCAAGCCCGGCAAGCCCGGCAAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3839832-3841235	Sequence	BCG_3505c - hypothetical protein (Protein is coded in complementary strand; from 3841235 to 3839832)