Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3755660
End position: 3755684
Length: 25

DNA sequence
>NC_008769, from 3755660 to 3755684 (25 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCGCGCCGGACCGCGCCGGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3754901-3755695	Sequence	BCG_3423c - hypothetical protein (Protein is coded in complementary strand; from 3755695 to 3754901)