Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3723935
End position: 3723979
Length: 45

DNA sequence
>NC_008769, from 3723935 to 3723979 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 ATTCGCCAACCCGACATTGCCAAACCCGACATTGCCCAACCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3720648-3724664	Sequence	BCG_3413c PPE54 PPE family protein (Protein is coded in complementary strand; from 3724664 to 3720648)