Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3570426
End position: 3570449
Length: 24

DNA sequence
>NC_008769, from 3570426 to 3570449 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCGGCGGCTGCGGCCGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3570165-3573014	Sequence	BCG_3269c secA1 preprotein translocase subunit SecA (Protein is coded in complementary strand; from 3573014 to 3570165)