Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3428064
End position: 3428093
Length: 30

DNA sequence
>NC_008769, from 3428064 to 3428093 (30 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCGTCGGCCTCGGCGACGGCATCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3427254-3428390	Sequence	BCG_3130c prfB peptide chain release factor 2 (Protein is coded in complementary strand; from 3428390 to 3427254)