Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3117911
End position: 3117937
Length: 27

DNA sequence
>NC_008769, from 3117911 to 3117937 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGGTGCCGGTGGTGCCGGAGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3116254-3118047	Sequence	BCG_2873 PE_PGRS48 PE-PGRS family protein