Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 3008667
End position: 3008690
Length: 24

DNA sequence
>NC_008769, from 3008667 to 3008690 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGGCGGCGACGGCGGCGACGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3007643-3008917	Sequence	BCG_2756 PE_PGRS47 PE-PGRS family protein