Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2938129
End position: 2938173
Length: 45

DNA sequence
>NC_008769, from 2938129 to 2938173 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCGGCGCCAACGCTGCCGGCGCAACCGATGCCGGCGCAACCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2937424-2938182	Sequence	BCG_2680 clpX' ATP-dependent protease ATP-binding subunit clpX'