Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2924696
End position: 2924722
Length: 27

DNA sequence
>NC_008769, from 2924696 to 2924722 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TTGCCGCCGTTGCCGCCCTGGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2924549-2926951	Sequence	BCG_2661c PE_PGRS46 PE-PGRS family protein (Protein is coded in complementary strand; from 2926951 to 2924549)