Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2867417
End position: 2867440
Length: 24

DNA sequence
>NC_008769, from 2867417 to 2867440 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGACACCGCCACCGACACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2866956-2867978	Sequence	BCG_2601c - hypothetical protein (Protein is coded in complementary strand; from 2867978 to 2866956)