Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2769163
End position: 2769186
Length: 24

DNA sequence
>NC_008769, from 2769163 to 2769186 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCACCGGCACCGCCATCGCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2768605-2770032	Sequence	BCG_2510c PE_PGRS43a PE-PGRS family protein (Protein is coded in complementary strand; from 2770032 to 2768605)