Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2765750
End position: 2765776
Length: 27

DNA sequence
>NC_008769, from 2765750 to 2765776 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCACCGTCGCCGCCGTCGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2765061-2768513	Sequence	BCG_2509c PE_PGRS43b PE-PGRS family protein (Protein is coded in complementary strand; from 2768513 to 2765061)