Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2760251
End position: 2760277
Length: 27

DNA sequence
>NC_008769, from 2760251 to 2760277 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCGCCGTCGCCGCCGTTGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2759609-2761192	Sequence	BCG_2506c PE_PGRS42ab PE-PGRS family protein (Protein is coded in complementary strand; from 2761192 to 2759609)