Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2742925
End position: 2742951
Length: 27

DNA sequence
>NC_008769, from 2742925 to 2742951 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGTCGATGTCGGCGATGTCGGCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2742558-2747429	Sequence	BCG_2496c gdh NAD-dependent glutamate dehydrogenase gdh (Protein is coded in complementary strand; from 2747429 to 2742558)