Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2673511
End position: 2673540
Length: 30

DNA sequence
>NC_008769, from 2673511 to 2673540 (30 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TGCTGTTGTTGTTGCTGCTGCTGTTGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2673499-2675154	Sequence	BCG_2427c - hypothetical protein (Protein is coded in complementary strand; from 2675154 to 2673499)