Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2658393
End position: 2658416
Length: 24

DNA sequence
>NC_008769, from 2658393 to 2658416 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGGCGGCGCCGGCGGGGGCTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2657876-2658958	Sequence	BCG_2411 PE_PGRS41 PE-PGRS family protein