Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2654659
End position: 2654686
Length: 28

DNA sequence
>NC_008769, from 2654659 to 2654686 (28 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCGCGGTGCGCTGTACGCGGTGCTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2653086-2655017	Sequence	BCG_2408 ggtB gamma-glutamyltranspeptidase precursor ggtB