Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2581251
End position: 2581277
Length: 27

DNA sequence
>NC_008769, from 2581251 to 2581277 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CAGTGCCAACAGTGCCAACAGTGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2580790-2581317	Sequence	BCG_2351c lppP lipoprotein lppP (Protein is coded in complementary strand; from 2581317 to 2580790)