Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2574421
End position: 2574444
Length: 24

DNA sequence
>NC_008769, from 2574421 to 2574444 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CAGCGCGAGCGCCAACGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2574104-2574952	Sequence	BCG_2346c - hypothetical protein (Protein is coded in complementary strand; from 2574952 to 2574104)