Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2515135
End position: 2515188
Length: 54

DNA sequence
>NC_008769, from 2515135 to 2515188 (54 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GGGGACGTGGTCGCCGGCGGCTGCGTGGTCGCCGGCGGCTGCGTGGTCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2515024-2516802	Sequence	BCG_2281c - hypothetical protein (Protein is coded in complementary strand; from 2516802 to 2515024)