Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2490724
End position: 2490753
Length: 30

DNA sequence
>NC_008769, from 2490724 to 2490753 (30 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGCCGAAGCCGACACCGACGCGGACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2490335-2491132	Sequence	BCG_2257c - hypothetical protein (Protein is coded in complementary strand; from 2491132 to 2490335)