Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2461219
End position: 2461254
Length: 36

DNA sequence
>NC_008769, from 2461219 to 2461254 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCCGCCCCCAAGCCCGCACCCAAGCCCGTCCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2460609-2462270	Sequence	BCG_2231 dlaT dihydrolipoamide acetyltransferase