Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2403707
End position: 2403733
Length: 27

DNA sequence
>NC_008769, from 2403707 to 2403733 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCACCGGCCCCACCGGCGCCGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403254-2404726	Sequence	BCG_2179c PE_PGRS38 PE-PGRS family protein (Protein is coded in complementary strand; from 2404726 to 2403254)