Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2398661
End position: 2398687
Length: 27

DNA sequence
>NC_008769, from 2398661 to 2398687 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GTGGCCAGCTTGGCCAGCGCGGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2397482-2399014	Sequence	BCG_2174c murF UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6- diaminopimelate-D-alanyl-D-alanyl ligase MurF (Protein is coded in complementary strand; from 2399014 to 2397482)