Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2367625
End position: 2367660
Length: 36

DNA sequence
>NC_008769, from 2367625 to 2367660 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CCCGCCGGCCCCGCCAGCCCCGCCCGCGCCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2367212-2367982	Sequence	BCG_2143c PE_PGRS37 PE-PGRS family protein (Protein is coded in complementary strand; from 2367982 to 2367212)