Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2286671
End position: 2286694
Length: 24

DNA sequence
>NC_008769, from 2286671 to 2286694 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TCGCCAACGCCATCGCGATCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2278183-2290638	Sequence	BCG_2067c pks12 polyketide synthase (Protein is coded in complementary strand; from 2290638 to 2278183)