Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2063076
End position: 2063102
Length: 27

DNA sequence
>NC_008769, from 2063076 to 2063102 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TCCGCCGGCGCCGCCGGCCCCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2062180-2063685	Sequence	BCG_1853c PE_PGRS33 PE-PGRS family protein (Protein is coded in complementary strand; from 2063685 to 2062180)