Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 2001743
End position: 2001769
Length: 27

DNA sequence
>NC_008769, from 2001743 to 2001769 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGCCCCACCCGCCCCACCCGCCCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2000361-2002769	Sequence	BCG_1799c wag22b PE-PGRS family protein (Protein is coded in complementary strand; from 2002769 to 2000361)