Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1988973
End position: 1989017
Length: 45

DNA sequence
>NC_008769, from 1988973 to 1989017 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GTGTTGCCAAAGCCGAAGTTGCCCAAGCCGGTGTTGGCAAACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1986774-1989854	Sequence	BCG_1792c PPE24 PPE family protein (Protein is coded in complementary strand; from 1989854 to 1986774)