Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1764985
End position: 1765029
Length: 45

DNA sequence
>NC_008769, from 1764985 to 1765029 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 AGTTGACGCTGCCCGTGTTGGCGCTACCCGGGTTGAAGCTGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1763628-1765664	Sequence	BCG_1601c PPE21 PPE family protein (Protein is coded in complementary strand; from 1765664 to 1763628)