Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1655851
End position: 1655886
Length: 36

DNA sequence
>NC_008769, from 1655851 to 1655886 (36 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCGCCGGTGCCGCCGGTGCCGCCGGTGCCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1655450-1659649	Sequence	BCG_1511c PE_PGRS27 PE-PGRS family protein (Protein is coded in complementary strand; from 1659649 to 1655450)