Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1643213
End position: 1643239
Length: 27

DNA sequence
>NC_008769, from 1643213 to 1643239 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGCCGTTGCCGCCGTTGCCGCCGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1643017-1644492	Sequence	BCG_1502c PE_PGRS26 PE-PGRS family protein (Protein is coded in complementary strand; from 1644492 to 1643017)