Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1514833
End position: 1514859
Length: 27

DNA sequence
>NC_008769, from 1514833 to 1514859 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCGCCGCCGGCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1514668-1516479	Sequence	BCG_1387c PE_PGRS24 PE-PGRS family protein (Protein is coded in complementary strand; from 1516479 to 1514668)