Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1509736
End position: 1509759
Length: 24

DNA sequence
>NC_008769, from 1509736 to 1509759 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TCGCGTACGCGTTCGCGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1509028-1510731	Sequence	BCG_1381c - adenylate cyclase (Protein is coded in complementary strand; from 1510731 to 1509028)