Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1415052
End position: 1415078
Length: 27

DNA sequence
>NC_008769, from 1415052 to 1415078 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GCCCCCGTCGCCCCCGACGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1414711-1416399	Sequence	BCG_1303c PE_PGRS23 PE-PGRS family protein (Protein is coded in complementary strand; from 1416399 to 1414711)