Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1180696
End position: 1180719
Length: 24

DNA sequence
>NC_008769, from 1180696 to 1180719 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 ACCGCCACCGCAACGGCCATCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1179589-1182171	Sequence	BCG_1085c kdpD sensor protein kdpD (Protein is coded in complementary strand; from 1182171 to 1179589)