Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1152152
End position: 1152196
Length: 45

DNA sequence
>NC_008769, from 1152152 to 1152196 (45 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 GGGATGCCGATGCCCGGGATGCCGATGCCCGGGATGCCGATGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1151378-1152637	Sequence	BCG_1061c - hypothetical protein (Protein is coded in complementary strand; from 1152637 to 1151378)